Volume 16, Issue 3 (May-Jun 2022)                   mljgoums 2022, 16(3): 14-18 | Back to browse issues page


XML Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Shalibeik S, Ghandehari F, Ahadi A, Rastegari A, Ghiasian M. Antibacterial Activity of the Peptide Microcin J25 Produced by Escherichia coli. mljgoums 2022; 16 (3) :14-18
URL: http://mlj.goums.ac.ir/article-1-1392-en.html
1- Department of Microbiology, Falavarjan Branch, Islamic Azad University, Isfahan, Iran
2- Department of Microbiology, Falavarjan Branch, Islamic Azad University, Isfahan, Iran , saman000_sh@yahoo.com
3- Department of Genetics, Faculty of Science, Shahrekord University , Shahrekord, Iran
4- Department of Molecular and cell Biochemistry, Falavarjan Branch, Islamic Azad University, Isfahan, Iran
Full-Text [PDF 649 kb]   (2988 Downloads)     |   Abstract (HTML)  (11311 Views)
Full-Text:   (4685 Views)
INTRODUCTION
Bacteriocins are generally active antimicrobial peptides against bacteria, closely related to the producer. Escherichia coli produce two bacteriocins: colicins and microcins (1). They destroy other bacteria via various mechanisms, including altering membrane permeability and depolarizing membrane ion gradients, or degrading nucleic acids or cell walls (2). The word bacteriocin is typically limited in literature to peptides generated by Gram-positive bacteria, while in Gram-negative bacteria, primarily enterobacteria, toxins are referred to as either colicins i.e. antibiotic proteins targeting E. coli or microcins that are characterized by lower molecular mass (3). With only 15 members known since their discovery in 1976, microcins form a very small community of defense peptides (4). They may be highly modified low-molecular-mass peptides below 5 kDa (microcins B17, C7/C51, D93, and J25) or polypeptides between 7 and 10 kDa that may or may not be modified (microcins E492, L, H47, I47, M, 24, and V) (5,6). Some of these peptides were known only on the basis of genetic analysis. Microcins share a conserved organization of their genetic systems in spite of a high structural heterogeneity. A typical gene cluster, located either on a plasmid or on the bacterial chromosome, includes open reading frames encoding the microcin precursor, secretion factors, immunity proteins, and modifying enzymes (6). MccJ25 was first described as a head-to-tail macrocyclic linear peptide (7). Later, with a unique three-dimensional structure, the peptide was described as a 'laso' peptide, revealing that the ring was simply a small cycle arising from a link between the amino group of the N-terminal and the side-chain carboxylate of Glu8 (7, 8). E. coli MccJ25 is a cyclic peptide, plasmid-coded, antibiotic composed of 21 unmodified amino acid residues (9). At the beginning of stationary growth, MccJ25 production is induced and adapted to iron-depleted environment (8, 9). MccJ25 is predominantly active on producer strain-related Gram-negative bacteria, with certain pathogenic bacteria hypersensitive to MccJ25 including Salmonella and Shigella species (10). Bacteriocins are usually safe and stable with therapeutic potential as broad-spectrum antimicrobial agents. The objective of this study was to evaluate antimicrobial activity of MccJ25 produced by the bacteriocinogenic E. coli.

MATERIAL AND METHODS
One hundred and twenty strains of E. coli were examined in this study. Bacteria strains were isolated from clinical specimens obtained from private diagnostic laboratories in Isfahan (Iran) from May 2020 to October 2020. The bacteria were cultured on blood agar and eosin methylene blue at 35 °C for 18-24 hours. Pure isolates were identified using Gram staining and biochemical tests including catalase test, Simmons citrate agar, sugar fermentation on triple sugar iron agar, gelatin hydrolysis test, indole production, nitrate reduction, urease production, Voges-proskauer test, methyl red, and presumptive test to confirm E. coli species.
Antagonistic activity of isolates was tested by adopting agar plug method. This method is commonly used to study antagonism between microorganisms. First, bacterial strain was inoculated onto agar plates previously inoculated with 107 -109 cfu/ml overnight culture of E. coli ATCC 25922. Cell free culture supernatants were obtained by centrifugation of overnight culture (109 cfu/ml) of E. coli strains at 12,000 g for 10 minutes at 4 ºC. The E. coli isolates from clinical specimens secrete molecules that diffuse in the agar medium; this medium was cut and placed on another agar plate inoculated with another microorganism. All the plates were then incubated at 37 ºC for 24 hours. Next, antimicrobial activity was evaluated by measuring diameter of inhibition zone surrounding the agar plug, which may provide an indication of diffused antimicrobial metabolites produced by the growing bacterial culture. The absence of an inhibition zone indicated a negative result for the production of bacteriocins (11, 12).
A set of primer targeting the MccJ25 gene was designed. The original sequence were retrieved from the NCBI GenBank, and Gene runner (version 6.5.52) was applied for qualification of the designed primers (Table 1).
Table 1. Sequences of the primers used in the study
Gene Sequence (5'→3') Amplicon Accession number
FAmcj25
ATGGAACTTCTTGTACTTGTCTG

470 bp

AF061787.1
RBmcj25 CATCCAGATAGCCGTTACCAGC

One colony of each bacterium was dissolved in 10 μl of sterile water and incubated at 95 °C for 10 minutes. Then, PCR buffer (1X), MgCl2 (1.5 mM), dNTP (200 μM), forward and reverse primers (0.4 μM each), and Taq polymerase enzyme (1 unit) were added to the bacterial colony for polymerase chain reaction (PCR). All reagents were purchased from Sinaclon Co., Iran. Cycling conditions were optimized as follows: initial denaturation for 5 minutes at 95 °C, 35 cycles of denaturation at 94 °C for 35 seconds, annealing at 58 °C for 35 seconds, extension at 72 °C for 30 seconds, and final extension at 72 °C for 5 minutes. The PCR reaction was carried out using the Boecco TC-SQ thermal cycler device (Germany). Finally, PCR products were electrophoresed on 1% agarose gel stained with green viewer fluorescent dye and visualized using an UV transilluminator.
A commercial PCR purification kit was used to purify PCR products, and sequencing was performed by FAZA Biotech Co. (Iran) using forward and reverse specific primers. The nucleotide sequences were analyzed with Chromasv2.1.1 software (http://technelysium.com.au), and sequence homology analysis was performed by using BLAST (http://www.ncbi.nlm.nih.gov/BLAST).

RESULTS
Of 120 clinical isolates, 25 (20.83 %) had large (5-7 mm) inhibition zones in agar well dilution method.
After the initial detection of E. coli strains, genomic bacterial DNA was extracted and applied on 1% agarose gel electrophoresis. The PCR products had a size of 470 bp.
Overall, 120 120 clinical specimens were infected with E. coli. The MccJ25 gene was detected in about 20% of E. coli isolates. All strains detected by the phenotypic methods were confirmed by PCR technique.

DISCUSSION
Antibiotic resistance among pathogenic bacteria is a serious public health concern. Traditional antibiotics must be used with caution to avoid generation and spread of antibiotic resistance, and other viable medications must be sought. Bacteriocins are ribosomally-synthesized proteinaceous compounds that are generally active against bacteria, often closely related to the producer (13). Microcins are bacteriocins produced by Enterobacteriaceae that inhibit E. coli and closely related strains (3, 14). In this study, the MccJ25 gene from E. coli was screened by PCR in 120 clinical specimens. In previous studies, the prevalence of bacteriocinogenic E. coli strains ranged from 25 to 55% (15-17). However, previous studies differ in terms of cultivation conditions, indicator bacteria used for detection of bacteriocin production, or the number of detected bacteriocin genes. In a previous study in Isfahan (Iran), about 40% of the clinical specimens contaminated with Klebsiella pneumoniae had the microcin E492 gene (15). In a study by Sable et al., MccJ25 showed inhibitory activity against 12 of the 15 DEC strains (16).
In one study on 105 E. coli strains, 4% of the strains contained four types of colicin, while in our study, 20% of the isolates contained MccJ25 (17).
 In a study by Jeziorowski et al. on E. coli 1308 samples, colicin Ia and microcin V were present in 10% and 5% of strains, respectively (18). In study of Tahamtan et al., all E. coli isolates had at least one colicin gene (19). In a study by Micenkova et al., of 1,181 E. coli isolates, 28 samples (7%) contained Microcin H47 and 18 samples (4.5%) contained Microcin V. Moreover, of 179 diarrhea samples, 14 (7.8%) contained microcin H47 and 18 (10.1%) contained microcin V. Of 603 extra-intestinal pathogenic E. coli samples, 165 (27.4%) contained microcin H47 and 152 (25.2%) contained microcin V.

CONCLUSION
MccJ25 is an antibacterial peptide that can be used in the next generation of antimicrobials as a good alternative to chemical antibiotics..

ACKNOWLEDGEMENTS
The authors would like to express their sincere gratitude to the Cultural and Research Department of Islamic Azad University of Falavarjan and the personnel of laboratories for their cooperation in this study.

DECLARATIONS
Funding
The authors received no financial support for the research, authorship, and/or publication of this article.

Ethics approvals and consent to participate
The study protocol was approved by the local ethics committee.

Conflict of interest
The authors declare that there is no conflict of interest regarding publication of this article.
Research Article: Research Article | Subject: Microbiology
Received: 2021/06/17 | Accepted: 2021/08/22 | Published: 2022/05/14 | ePublished: 2022/05/14

References
1. Juturu V, Wu JC. Microbial production of bacteriocins: Latest research development and applications. Biotechnology advances. 2018; 36(8): 2187-200. [View at Publisher] [DOI:10.1016/j.biotechadv.2018.10.007] [PubMed] [Google Scholar]
2. Rostami FM, Mousavi H, Mousavi MR, Shahsafi M. Efficacy of probiotics in prevention and treatment of infectious diseases. Clinical Microbiology Newsletter. 2018; 40(12): 97-103. [View at Publisher] [DOI:10.1016/j.clinmicnews.2018.06.001] [Google Scholar]
3. Zimina M, Babich O, Prosekov A, Sukhikh S, Ivanova S, Shevchenko M, et al. Overview of global trends in classification, methods of preparation and application of bacteriocins. Antibiotics. 2020; 9(9): 553. [View at Publisher] [DOI:10.3390/antibiotics9090553] [PubMed] [Google Scholar]
4. Martinez JL, Perez-Diaz JC. Isolation, characterization, and mode of action on Escherichia coli strains of microcin D93. Antimicrobial agents and chemotherapy. 1986; 29(3): 456-60. [View at Publisher] [DOI:10.1128/AAC.29.3.456] [PubMed] [Google Scholar]
5. Huang K, Zeng J, Liu X, Jiang T, Wang J. Structure of the mannose phosphotransferase system (man-PTS) complexed with microcin E492, a pore-forming bacteriocin. Cell discovery. 2021; 7(1): 1-5. [View at Publisher] [DOI:10.1038/s41421-021-00253-6] [PubMed] [Google Scholar]
6. Collin F, Maxwell A. The microbial toxin microcin B17: prospects for the development of new antibacterial agents. Journal of molecular biology. 2019 Aug 23;431(18):3400-26. [View at Publisher] [DOI:10.1016/j.jmb.2019.05.050] [PubMed] [Google Scholar]
7. Martin-Gómez H, Tulla-Puche J. Lasso peptides: chemical approaches and structural elucidation. Organic & biomolecular chemistry. 2018; 16(28): 5065-80. [View at Publisher] [DOI:10.1039/C8OB01304G] [PubMed] [Google Scholar]
8. Rebuffat SF, Telhig S, Said LB, Zirah S, Ismail F. Bacteriocins to thwart bacterial resistance in Gram-negative bacteria. Frontiers in microbiology. 2020;11:2807. [View at Publisher] [DOI:10.3389/fmicb.2020.586433] [PubMed] [Google Scholar]
9. Naimi S, Zirah S, Hammami R, Fernandez B, Rebuffat S, Fliss I. Fate and biological activity of the antimicrobial lasso peptide microcin J25 under gastrointestinal tract conditions. Frontiers in microbiology. 2018; 9: 1764. [View at Publisher] [DOI:10.3389/fmicb.2018.01764] [PubMed] [Google Scholar]
10. Koltan M, Corbalan NS, Molina VM, Elisei A, de Titto GA, Eisenberg P, et al. Anti-E. coli cellulose-based materials. LWT. 2019; 107: 325-30. [View at Publisher] [DOI:10.1016/j.lwt.2019.02.084] [Google Scholar]
11. El-Kholy M, El-Shinawy S, Meshref A, Korny A. Screening of Antagonistic Activity of Probiotic Bacteria Against Some Food-Borne Pathogens. Journal of Food Biosciences and Technology. JFBT. 2014; 4(2): 1-14. [View at Publisher] [Google Scholar]
12. Ayeni FA, Adeniyi BA, Ogunbanwo ST, Tabasco R, Paarup T, Peláez C, Requena T. Inhibition of uropathogens by lactic acid bacteria isolated from dairy foods and cow's intestine in western Nigeria. Archives of microbiology. 2009 Aug;191(8):639-48. [View at Publisher] [DOI:10.1007/s00203-009-0492-9] [PubMed] [Google Scholar]
13. Gradisteanu Pircalabioru G, Popa LI, Marutescu L, Gheorghe I, Popa M, Czobor Barbu I, et al. Bacteriocins in the Era of antibiotic resistance: rising to the challenge. Pharmaceutics. 2021; 13(2): 196. [View at Publisher] [DOI:10.3390/pharmaceutics13020196] [PubMed] [Google Scholar]
14. Sassone-Corsi M, Nuccio SP, Liu H, Hernandez D, Vu CT, Takahashi AA, et al. Microcins mediate competition among Enterobacteriaceae in the inflamed gut. Nature. 2016; 540(7632): 280-3. [View at Publisher] [DOI:10.1038/nature20557] [PubMed] [Google Scholar]
15. Nasresfahani M, Ahadi A M, Ayat H, Nayeri H. Evaluation of E492 Microcin Gene Presence in Klebsiella pneumoniae Collected from Patients Registered to Educational Hospitals of Isfahan. Zahedan J Res Med Sci. 2017; 19(1): e5038. [View at Publisher] [DOI:10.17795/zjrms-5038] [Google Scholar]
16. Sable S, Pons AM, Gendron-Gaillard S, Cottenceau G. Antibacterial activity evaluation of microcin J25 against diarrheagenic Escherichia coli. Applied and environmental microbiology. 2000; 66(10): 4595-7. [View at Publisher] [DOI:10.1128/AEM.66.10.4595-4597.2000] [PubMed] [Google Scholar]
17. Budič M, Rijavec M, Petkovšek Ž, Žgur-Bertok D. Escherichia coli bacteriocins: antimicrobial efficacy and prevalence among isolates from patients with bacteraemia. PLoS One. 2011; 6(12): e28769. [View at Publisher] [DOI:10.1371/journal.pone.0028769] [PubMed] [Google Scholar]
18. Jeziorowski A, Gordon DM. Evolution of microcin V and colicin Ia plasmids in Escherichia coli. Journal of bacteriology. 2007; 189(19): 7045-52. [View at Publisher] [DOI:10.1128/JB.00243-07] [PubMed] [Google Scholar]
19. Hyati M, Kargar M, Pourbakhsh A, Shirazi Z, Tahamtan Y, Namvari M, et al. Detection of Colicin genes by PCR in Escherichia coli isolated from cattle in Shiraz-Iran. Archives of Razi Institute. 2012; 67(1): 63-67. [View at Publisher] [DOI] [Google Scholar]
20. Micenková L, Štaudová B, Bosák J, Mikalová L, Littnerová S, Vrba M, Ševčíková A, Woznicová V, Šmajs D. Bacteriocin-encoding genes and ExPEC virulence determinants are associated in human fecal Escherichia coli strains. BMC microbiology. 2014; 14(1): 1-9. [View at Publisher] [DOI:10.1186/1471-2180-14-109] [PubMed] [Google Scholar]

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.